CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3Modding quick questions and answers! Ask modding questions here. Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. log for most game versions since launch. } Saved scopes will stay saved within the current code chain. 11 bookmarkCK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . CK2 Cultures Reborn, a CK3 mod (OUTDATED) Do you miss Arberian, Carantanian, Coptic, Crimean Gothic, and Dalmatian from CK2? You can now find them here, complete with all the characters, name list, and cultural names. This is a non-profit project by fans, for fans. Paradox / Steam. Press tilde to enter debug mode. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. . Use DNA String code to change selected character must installed Cheat Engine and download ck3_1. 8. mother = scope:other_character. CK3 Wiki Active Wikis. 0, generated via automated export from the game files. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 8. These are the color-coded direct scopes as of 1. Don't get me wrong I know living to your 70s and 80s wasn't unheard of back in the middle ages, but it's way too common in CK3, for instance average lifespan was 31 in medieval England, I know child mortality contributed to that statistic but I'll get to that later. Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. 8 CombatSide 4. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. If you have any knowledge on these, please feel free to contribute and help the documentation grow! Reply. Putting a condition check inside an effect block will be flagged up as incorrect, as will trying to check if a scheme scope = root when root is a character. 2. 9. Database Scopes One larger rework that will be a work in progress over the next few patches is that now database types can be registered as scope types. 8 CombatSide 4. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis. These are the color-coded direct scopes as of 1. At least some were last verified for version 1. CK3 Wiki Active Wikis. These are the color-coded direct scopes as of 1. 11. 3 Scope Debugging;EDIT: Figured it out. Robin's Enhanced Details and History expands the game world by increasing the level of detail, specifically through the addition of provinces, complete with new titles, characters, and coats of arms from history. This both makes your file smaller over all, and makes it easier to update the. LAST UPDATED CK3 VERSION 1. . trigger = { root. But kinda not that much on scopes. character behaviors. 2 ActiveCouncilTask 4. Realm bonuses include bonuses to men-at-arms and. Localization refers to the text presented to the player in events, menus, decisions, UI, and any other string of text in any window in the game. These are the color-coded direct scopes as of 1. 4, generated via automated export from the game files. The CK3 Human Phenotype Project is a mod aimed at making the appearences of characters more realistic and diverse by replicating various phenotypes found on the website humanphenotypes. dds files for textures, which are saved inside the game/gfx/ folder. 4 Types 4. mother = scope:other_character. . Learn More Submit Now About . Why Publish with PLOS ONE. Supported scopes is basically the left half of the effect, so if you call a "set_county_culture" against a ruler, it won't work, since that effect is only scoped to landed titles and you would need to instead use the "set_culture" effect, which has a supported scope for characters. 0 unless otherwise noted. The game was revealed at PDX Con 2019 in October, and released on September 1, 2020. Type "explorer" to get the explorer window up. Crusader Kings III is our newest generation of beloved medieval role-playing grand strategy game. 24 War Scopes. trigger = { root. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . G. To get to vanilla dutch, you'd need to spawn it somehow and convert to it in CK3,which is beyond the scope of help I can give you. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Use GitHub file history feature to compare_versions. Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. 0001 #Starts "negotiations"}}} auto_accept = yes} In blue are the conditions: 1. 3 Activity 4. 8. A tool that generates an image for river flow, based on an input heightmap. 3. Dev Diary #126 - Modding Activities. Debug info about the current scope context and how keys used to build the description. Introducing CK3 #01 - Characters. The core [`Scopes`] type which tracks our knowledge about the types of in-game values. Use script_docs and dump_data_types console commands in the game to generate them. . CK3 should absolutely have a less stale. And our new UI system is the most open we’ve had in terms of what custom UIs mods can add and edit, but one issue it had was letting you add brand new things entirely and keeping compatibility nicely. Nice place. Note that in some cases there may be no root, so make sure your first check is a fallback for "NOT = { exists = this }" if you add dynamic names, descs, or icons. 6 Character 4. 3 Dynasty house 2. True to the rather expansive nature of CK3,. Events belong in a . -) Pregnancies are more risky and is highly depending on age and health-status of becoming mother. These are the color-coded direct scopes as of 1. Any dates outside of that, like the Oblivion Crisis of 3E 433 or the Dragon Crisis of 4E 201, are. 4. Expand and improve your realm, whether a mighty kingdom or modest county. 4. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 4, generated via automated export from the game files. Je n'ai pas finit la traduction c'est pour ça que la traduction est en Alpha voir pré-Alpha. limit = { title = d_new_merc } # This scopes to the holder of the title i. 4. CK3 triggers, modifiers, effects, event scopes, event targets, on actions, code revisions and setup. Legacy Wikis. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Either open your mod folder directly. These are the color-coded direct scopes as of 1. Scripting. 1 Example 2 List of scopes 2. Take a look into vanilla CK3 files and see how they populate lists with "add_to_list"CK3 Wiki. Every single time my character lives past 65 with no. Well, is a sort of yes and no situation. 0. 0. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. (only for alerts)","random_alert_usurpable_title = { limit = { } (optional) weight = { mtth } }","Supported Scopes: character","Supported Targets: landed title","","-----","","random_ally - Iterate through all allies","random_ally = {. Install this extension. any_mercenary_band = { # This limits the scope to a mercenary company which has the title name "d_new_merc". 5 Secret Modifiers are applied to different scopes. Making republics playable is beyond the scope of the initial converter release, and it will probably be done by a DLC. This should solve empires sticking around forever as micro-realms. 8. Since there is nothing that tells the AI to marry close family if you have Divine Marriage, how would I go about modding that oversight? In particular, how. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator:. Boosted the control gain from requesting Bailiffs from your Liege in a Petition. Jump to latest Follow Reply. e. CK3 uses . Reflecting that might make sense for the base game,. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. F. 4, generated via automated export from the game files. 18 Religion 4. At least some were last verified for version 1. Legacy Wikis. CK2 Cultures Reborn, a CK3 mod (OUTDATED) Do you miss Arberian, Carantanian, Coptic, Crimean Gothic, and Dalmatian from CK2? You can now find them. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . An empty trigger is treated as 'no'. These are the color-coded direct scopes as of 1. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . mother = scope:other_character. Use script_docs and dump_data_types console commands in the game to generate them. 7 Combat 4. } Saved scopes will stay saved within the current code chain. Note that in some cases there may be no root, so make sure your first check is a fallback for "NOT = { exists = this }" if you add dynamic names, descs, or icons. trigger = { root. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. } Saved scopes will stay saved within the current code chain. "C:Program Files (x86)SteamsteamappscommonStellaris". 4. To do this I will use the "if" scope. trigger = { ROOT = { province = 1 } } immediate = { # This scopes to all mercenary company titles in the game. Scopes always have a bracketed block on the right side: <scope_name> = { #Stuff to execute in the scope. 0, generated via automated export from the game files. } Saved scopes will stay saved within the current code chain. These traits are temporary, and they go away once a child becomes an adult. 17 Province 4. The second is something that changes the chances of random effects happening. } Saved scopes will stay saved within the current code chain. CK3 Wiki Active Wikis. Member the -= Paradox Game Converters =- Team. Source: event_targets. trigger = { root. Supported scopes is basically the left half of the effect, so if you call a "set_county_culture" against a ruler, it won't work, since that effect is only scoped to landed titles and you would need to instead use the "set_culture" effect, which has a supported scope for characters. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. Crusader Kings. com] EPE Female DNA 01 DNA String: Persistent DNA: EPE. 4. joined_faction. } Saved scopes will stay saved within the current code chain. 4. Content is available under Attribution-ShareAlike 3. The events directory may also have sub. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 0 See event_targets. 9 Options 10 After 11 Widgets 12 On Actions (on_action) 12. 4, generated via automated export from the game files. The game follows the mechanical structure of its predecessors, with. CK3 wiki for example says that there is`debug_log_scopes` effect that evaluates to true and logs its internal scope. 2 Landed title 2. By disabling it, the problem reoccurs. It is opposed to static history modding, though some scripts may exceptionally be triggered from history files. In this first video One Proud Bavarian will help us understand the gallery of characters that we will play and what they are made of!. 0, generated via automated export from the game files. According to CK3 Wiki the console command for name change is below you need to run the game on debug mode via " -debug_mode " command on start its written in wiki too. 2_code. These are the color-coded direct scopes as of 1. 2 and corrupted, and you're exporting to 1. 0MB ;They are declared in common/event_themes/" From CK3 Wiki about event modding As I said in the first comment it can be triggered yearly(its random) if you have a relic, a weapon that is equipped and that isn't already. 9. Use script_docs and dump_data_types console commands in the game to generate them. This article is timeless and should be accurate for any version of the game. If a province is out of CK3's scope, it is left untouched. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. } Saved scopes will stay saved within the current code chain. cpp:276]: Script system error! Error: rarity trigger [ Wrong scope for trigger: none, expected artifact ] Script location: file: common/scripted_effects; add_scaled_artifact_modifier_grandeur_small_effect line: 11- CK3 Mod Co-op Co-Owner-Lead Developer on CK3 A Game Of Thrones, Kingdom of Heaven, Catholic Trinity, Dynamic Crusader States - Developer on the Expanded Mod Series. 2. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 0, generated via automated export from the game files. use. After learning how to use Visual Studio Code's very helpful CWTools extension (thanks folks!) to browse CK3's code, I found the actual formula to decide how many kids you get. Modding quick questions and answers! Jia Xu Sep 1, 2020 Jump to latest Follow Reply Ask modding questions here. I. 12 Dynasty 4. mother = scope:other_character. Modding,. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 0, generated via automated export from the game files. These are the color-coded direct scopes as of 1. 4. 4. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Hi everyone, I am struggling to understand how CK3 uses event scopes, as I am too used to Ck2 and EU4. 3) of the game. Crusader Kings. [CK3] Dualism is so painfully misrepresented it makes me want to break something. lolCrusader Kings. 4, generated via automated export from the game files. trigger = { root. 0 See `event_targets. Ask modding questions here. 4. then simply use the create_alliance effect/command with that saved scope as the target. (CK3) Help Hi all, I'm just curious if there's a way that I can occupy a province in a war using console commands, or find a console command to end a war (as a secondary participant) on my behalf? I haven't had any luck with the internet, so I just wanted to ask to make sure if it even exists. This article has been verified for the current version (3. 4. I’m Matthew, one of the programmers on the team, and today we’re going to be covering changes to modding support coming alongside Tours and Tournaments as well as how modding activities themselves can work. Marriage Mod Creation? Grand Admiral Edward. Open comment sort options. Click the character's name/tag under the "Key" column. } Saved scopes will stay saved within the current code chain. trigger = { root. e a game object, like Character or Province, while a function returns a number, a string or a boolean (true/false), etc. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 1 MP Checksum for 1. The trick is to first save the character you want to ally with as a saved scope variable. LAST UPDATED CK3 VERSION 1. Being a busy and dedicated man, she lived amongst books until her father recruited a scholar to teach her. you can use "c_char#" as the scope. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Every single character is an individual, living entity that will act. That is nicely done. These are the color-coded direct scopes as of 1. 0, generated via automated export from the game files. These are the color-coded direct scopes as of 1. Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Localization refers to the text presented to the player in events, menus, decisions, UI, and any other string of text in any window in the game. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . are a scope type, it has its pros and cons. (CK3) Help Hi all, I'm just curious if there's a way that I can occupy a province in a war using console commands, or find a console command to end a war (as a secondary participant) on my behalf? I haven't had any luck with the internet, so I just wanted to ask to make sure if it even exists. 0, generated via automated export from the game files. I would like to make an effect in the Run file that restores all missing/wrong traits, but I can't find any scope in the wiki that allows me to target all living characters. These are the color-coded direct scopes as of 1. Personally, if I'm playing as the child myself, I want to increase my chances of having decent personality traits, even if it means a sub-par education trait. It would look like "c_163109 = { #put your script/event here}". 4, generated via automated export from the game files. scopes. Crusader Kings III. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Click to expand. 0. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. } Saved scopes will stay saved within the current code chain. mother = scope:other_character. scope:recipient = {allowed_to_marry_same_sex_trigger = no sex_same_as = scope:secondary_actor}In the game I'm currently playing, I'm holding Skåne. 4 Army 4. mll. It is the sequel to Crusader Kings II which was released in 2012 and received content expansions until 2018 and then went free-to-play for the base game. 4. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . CK3 Scope Overview Chart. Jul 15, 2021. 0, generated via automated export from the game files. I'm trying everything, tried the ID, the historical ID, nothing works. It combines refined poetry, storytellers and runestone raisers in to one tradition. change_first_name = scope:name/var:name change_first_name = { template_character = scope:character } But how can we do that exactly ? What is the localization key ? And what about the others ? That command is very tricky. 1, you can open your ck3. } Saved scopes will stay saved within the current code chain. However, because CK3 map is special, you need to "degrade" it first using mapDegrader:. The supported target is the value that can be passed to it. 8. 2_code. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. mother = scope:other_character. faction_leader`. Github. We refer to these scope types as primitive scopes due to their basic nature and generally not. In theory, in ck3 since there are not ppl with 150 different personality traits like in ck2, it should be easier to make NPC characters act their personality traits way. The list is incomplete, i checked game files, and there is a lot of scopes that do not show on wiki. mother = scope:other_character. 4. 11. heal – This command will heal you and any nearby. These are the color-coded direct scopes as of 1. 4. 11 bookmarkFirst, congratulations. 11 CultureGroup 4. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. For more utilitarian scripted triggers that need to be used across multiple files, the old folder system still works. 10. In this first video One Proud Bavarian will help us understand the gallery of characters that we will play and what they are made of!. Thank you all for your help!CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . ? History (for CK3): Are spouses, employers, and lieges alive on the relevant dates? Is no one their own grandfather? Special: rivers. } Saved scopes will stay saved within the current code chain. trigger = { root. Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. blackninja9939. 4, generated via automated export from the game files. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Recipient's direct liege is you. 23 TopScope 4. Hi, I am having problem while running the code: qiime cutadapt trim-paired --i-demultiplexed-sequences demux. The same is true for various character IDs. 0, generated via automated export from the game files. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. Is there a file somewhere, that lists all scopes, maybe? I digged around for 2-3 hours, but didn't find. 5 Artifact 4. Each file can hold as many events as one would like. Find many great new & used options and get the best deals for Sniper MT4-12x50 SFP Hunting Rifle Scope R/G/B Illuminated 1'' Tube Parallax ad at the best online prices at eBay! Free shipping for many products!The developers of CK3 already seem open to the idea of dedicating whole systems for certain historical processes, such as the struggle system present in Iberia. Is there a file somewhere, that lists all scopes, maybe? I digged around for 2-3 hours, but didn't find anything. or open the Game folder containing your mods. A new window called "Object Inspector" should appear. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Scopes. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3For example, if you wanted to give whoever holds the county of roma a modifier, you could run this: effect = {title:c_roma = { holder = { add_character_modifier = governance_building_lessons_learned_modifier } } } If you want to apply it to yourself, the default scope is the character, so you could ignore all the title/holder stuff, like so. 3D models. . . mother = scope:other_character. Base Ck3 was good but after two years it’s still missing a lot of content from 2, especially plagues, empire mechanics, republics etc. Use script_docs and dump_data_types console commands in the game to generate them. 1 Culture 2. Kingdoms ruled by a King, and Empires ruled by an Emperor. 49. 4, generated via automated export from the game files. 4, generated via automated export from the game files. trigger = { root. trigger = { root. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. (My credentials are reading through the code, so I added sources so people can retrace my steps. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. ) There are two, completely independent ways to get pregnant. The events directory may also have sub-folders containing their own event files, if one prefers. 4, generated via automated export from the game files. mother = scope:other_character. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis. qza --p-cores 16 --p-adapter-f AAGCTCGTAGTTGAATTTCG --p-adapter-r CCCAACTATCCCTATTAATCAT -. It's now standing on its own two feet and will grow. Just google the following keywords: "ck3 modding" "ck3 event modding" "ck3 decision modding" "ck3 effects" "ck3 triggers" "ck3 scopes" "ck3 modifier list" and sift through them with confused pain like the rest of us .